Watch the shocking moment Conor McGregor tries to touch a woman’s breast during a wild bender in his Dublin bar from 209 dj Watch Video

Preview(s):

Play Video:
(Note: The default playback of the video is HD VERSION. If your browser is buffering the video slowly, please play the REGULAR MP4 VERSION or Open The Video below for better experience. Thank you!)
⏲ Duration: 1:6
👁 View: 1.2M times
✓ Published: 29-May-2024
Open HD Video
Open MP4 Video
Download HD Video
Download MP4 Video
Description:
MMA megastar Conor McGregor appeared to pull open a woman's blouse while partying in his Dublin bar just six weeks before his UFC comeback fight against Michael Chandler.<br/><br/>The former UFC lightweight and featherweight champion had previously hinted that he would be going on a self-imposed alcohol ban ahead of his bout at UFC 303 on June 30.<br/><br/>And while he wasn't seen drinking in any of the clips posted to social media, he did appear to be partying very hard.<br/><br/>In one clip he can be seen dancing and sharing a kiss with his fiancée Dee Devlin, who is seen wearing a black outfit that evening.<br/><br/>In another, the former champ can be seen filming himself dancing with others, before the camera pans away to an unidentified woman in a leopard-print outfit.<br/><br/>McGregor's hand, with his signature tattoo, then appears to try and open the woman's blouse and touch her chest.<br/><br/>The woman in question rebuffs the move, and the video abruptly ends. <br/><br/>The Mail has contacted McGregor's management for comment.<br/><br/>McGregor was also pictured in a series of separate videos posing behind the DJ decks along with several fans. In another clip, he raised a bottle of whiskey into the air while dancing behind the decks.<br/><br/>One video showed the 35-year-old arriving at the venue via a luxurious soft-top Bently before the MMA star strutted into the bar wearing a pair of sunglasses while a flare went off next to him.<br/><br/>His long-awaited return to The Octagon was confirmed in April, with the MMA star, who owns the Proper No 12 whisky and stout brand, recently stating he would be committing to clean living ahead of the bout.<br/><br/>In a post to American pop star Justin Bieber, McGregor wrote: 'My brother, the Mac has your back for life! From Beverly Hills to the Bahamas!<br/><br/>'See you in Vegas bro, it's game on, the Mac is back!<br/><br/>'Five more nights on the delicious and then that be that see ya's tonight I NOTLEAVING.'

Share with your friends:

Whatsapp | Viber | Telegram | Line | SMS
Email | Twitter | Reddit | Tumblr | Pinterest

Related Videos

Paris Hilton is officially back in her pop princess era. The star announced yesterday that her second album, entitled Infinite Icon, is due to drop on September 6, with the first single expected to land sometime in June.
⏲ 0:39 👁 405K
AstroLife
⏲ 2 hours 15 minutes 8 seconds 👁 4.2K
Dj Silviu M Official
⏲ 1 hour 48 seconds 👁 11.4M
American DJ and producer CRANKDAT shares his excitement about performing at the 2024 Electric Daisy Carnival in Las Vegas, the biggest electronic dance music festival in North America.
⏲ 1:10 👁 11.2M
Motry
⏲ 1 hour 3 minutes 9 seconds 👁 1.7M
&#60;br/&#62;Description&#60;br/&#62;&#60;br/&#62;Hey friends This Is Lakshman Welcome To Our daily motion Channel. Here I presenting You All Types Of DJ Songs. Regular update my channel&#60;br/&#62; Like Comments And Share Our Videos Thank U. I Hope You Enjoying Our Videos.&#60;br/&#62;&#60;br/&#62;Please Subscribe Our Channel For More DJ Songs updates&#60;br/&#62;
⏲ 14:15 👁 110K
DJ LEONAN
⏲ 50 minutes 29 seconds 👁 481.8K
X U R I 81. 𝕿𝖊𝖈𝖍𝖓𝖔 𝕭𝖆𝖓𝖉𝖎𝖙
⏲ 1 hour 47 minutes 5 seconds 👁 45

Related Video Searches

Back to Search

«Back to 209 dj Videos

Search Videos

Recent Searches

bk opan hindi eslamik song | মেয়েরা কিভাবে হাত মারে | collage ga gp | dolly de remorquage occasion | é | www নতুন বোউয়ের কে বাশর রাতে বিতরে দিলে কেমন লাগেনিয়াম কি বাবে বলে 100 রান এর kajal t | efalghedw s | s8mqid ayre | karnoun doulma | indian bangla range aux com | zulu dance ass | www videos মেয়েদের ছবি | skrita kamera bratislava | sandal jat | মৌসমী photos | dhige bangla song | 02 madokashokto gene split | tap muzic comhaag rath | bangla nokia messenger | www 14মেয়দের com | bangla movie song sabnur rajzgla school girls | ba32 baker act | iron fitness st soupplets | হানিছিগার | sehar ka waqt tha naat | ফটওয়িকা মাহি ছবিকা মাহিয়া মাহি পিকচার | ঠাকুর মা ঝুড়ি কাটুন | crack head outside | tor ak kothi ami thro hagar bajee | prank photo nokia munmun full girl big | ভারতি বাংলা images com জোর করে 3gp video চ | belinda russell weather 2017 | گازیل کشی | riyaj filmww bangla six vido | সাকিব খান বছগিরি ছবি | rangbazz mp3 song | rooftop prince trailer | misbila3crs | loudoun csl center | the layover movie 2017 full movie | তানভীর স্যার | robindro songs hemontoay | দেশি | বাংলা মি বিন ভিডিও | rupsagara moner manus | bangla movie khodar pore ma er sakib and sahara y video পলি ছব | dance moms brookeseason 4 | www হিনদু কোয়েলের মেয়েদের ও | বাংলার ছায়াছবির গান | kolae | bang 15 mpegivideo mpeg 4 | my reaction to a bad thing 82 joseph gaming | iz0pldkcvcs | ggcaccatcatcaagcccaag | meaning of north star | photos video d sabonti full hot বাংলা | definition of moral education | goggles4u uk | jealne by becky g | nagin serial part6 | iexplore exe download | michael panicello | nirvana album | dogs exclusive | ae rascal phone uthao quick gun murugun | the first muvi universor | bangla hakka wap | christiane | reaching banerjee video www com | bts connector | www com baby you | deo com hp line | yoona | sarah nogori dhakar bud | katrina se videos | ছেলেদের সনু দেখাও | indian bangla ma amar movies fast an vide | 1968 dodge dart | বিউটিফুল | নটক বন্ধুবৃও | shakib khan new movies video song |