Kareena Kapoor, Saif Ali Khan, Soha celebrate Saba Pataudi’s birthday from misir ali series Watch Video

Preview(s):

Play Video:
(Note: The default playback of the video is HD VERSION. If your browser is buffering the video slowly, please play the REGULAR MP4 VERSION or Open The Video below for better experience. Thank you!)
⏲ Duration: 1:50
👁 View: 19.6M times
✓ Published: 03-May-2024
Open HD Video
Open MP4 Video
Download HD Video
Download MP4 Video
Description:
Saba Pataudi celebrated her birthday recently. The party was attended by Kareena Kapoor, Saif Ali Khan, Soha Ali Khan, Ibrahim and other family members. The pictures of this star studded family gathering have been rapidly going viral on social media.<br/><br/>#kareenakapoorkhan #saifalikhan #taimur #jeh #bebo #pataudifamily #entertainmentnews #bollywood #viralvideo #trending

Share with your friends:

Whatsapp | Viber | Telegram | Line | SMS
Email | Twitter | Reddit | Tumblr | Pinterest

Related Videos

Leeds Green councillor Mothin Ali elected in Gipton and Harehills from misir ali series
⏲ 0:29 👁 16.1M
My AudioBook
⏲ 3 hours 20 minutes 23 seconds 👁 36.5K
Golpo Toru । গল্প তরু
⏲ 1 hour 48 minutes 15 seconds 👁 9.7K
Audio Book Bangla by Faheem
⏲ 32 minutes 39 seconds 👁 26.1K
Repair Mind (RM)
⏲ 2 minutes 43 seconds 👁 4.4K
&#60;br/&#62;Watch all the episodes of Jaan e Jahan&#60;br/&#62;https://bit.ly/3sXeI2v&#60;br/&#62;&#60;br/&#62;Subscribe NOW https://bit.ly/2PiWK68&#60;br/&#62;&#60;br/&#62;The chemistry, the story, the twists and the pair that set screens ablaze…&#60;br/&#62;&#60;br/&#62;Everyone’s favorite drama couple is ready to get you hooked to a brand new story called…&#60;br/&#62;&#60;br/&#62;Writer: Rida Bilal &#60;br/&#62;Director: Qasim Ali Mureed&#60;br/&#62;&#60;br/&#62;Cast: &#60;br/&#62;Hamza Ali Abbasi, &#60;br/&#62;Ayeza Khan, &#60;br/&#62;Asif Raza Mir, &#60;br/&#62;Savera Nadeem,&#60;br/&#62;Emmad Irfani, &#60;br/&#62;Mariyam Nafees, &#60;br/&#62;Nausheen Shah, &#60;br/&#62;Nawal Saeed, &#60;br/&#62;Zainab Qayoom, &#60;br/&#62;Srha Asgr and others.&#60;br/&#62;&#60;br/&#62;Watch Jaan e Jahan every FRI &amp; SAT AT 8:00 PM on ARY Digital&#60;br/&#62;&#60;br/&#62;#jaanejahan #hamzaaliabbasi #ayezakhan#arydigital #pakistanidrama &#60;br/&#62;&#60;br/&#62;Pakistani Drama Industry&#39;s biggest Platform, ARY Digital, is the Hub of exceptional and uninterrupted entertainment. You can watch quality dramas with relatable stories, Original Sound Tracks, Telefilms, and a lot more impressive content in HD. Subscribe to the YouTube channel of ARY Digital to be entertained by the content you always wanted to watch.&#60;br/&#62;&#60;br/&#62;Join ARY Digital on Whatsapphttps://bit.ly/3LnAbHU
⏲ 38:39 👁 7.7M
Golpo Toru । গল্প তরু
⏲ 2 hours 32 minutes 30 seconds 👁 4.3K

Related Video Searches

Back to Search

«Back to misir ali series Videos

Search Videos

Recent Searches

www indian comt girl cox bazardahakawap comjibon gelo bangla mp3 by upolgamewww google wap comitihash muvi আলমগীর এর ছেক্র ভিডিও | আপু সাথে ভিডিও | bangla movie hot song dipjol রাই | নাইকা নুসরাতের ডাউনলেড | ztqykdtg0uo | www bangla video hindi movie sexyngla funey video karum naitok 2015inde song cfg contactform inc 19 upload phpw ph0t0s c0mt photokoel payel puja saefbfbde0a6bee0a6b9e0a6bfe0a79fe0a6be e0a6aee0a6bee0a6b9e0a6bf e0a68fe0a695e0a78de0a6b8 e0a6ade0a6bfe0a6a1e0a6bfe0a69cfg 1inc জাতিয় সংগিত¿ | bobby deol movies new 2020 | galanga thai | সাকি ব | vggx fpvygy | bangla new eid song video 2015লতে চেয়ে মন§ | tu por el video oficial ft mozart la pa | disease spread by contact | bangla bipul | esha deol photo full besh koraci prem 2015¦­à¦¾à¦¬à§‡ | www runs com gal song | رقص طیزعمانی | ki jadu by im | amarpalli hot songs | fdr services hempstead | অপু বিশশার | খুলনা কলেজের মেয়েদের ভুদার | ggggccactagggacaggat | hafizur rah why do we laugh tomato lok | ancholik gaan | bangladeshi actores mahiya mahi video youtube | bangladeshi girl big photo nakata list comla 3gp | qq9zxakwz60 | bangla movie song salma b | bangla http বাংলা video ফরিদপুর পার english com porn wap putul sorkar দেশি নায়কা অপু বিশাস এর ভিডিও | bangla hot bideo songson pran the | vhsmooseandzee | bala our osman | রমজানের গজল ২০১৯ | pagol mon gan bondu tumi amar janer jan sajjad nur mp3 song | www fusionbd com vido mp4p | representative heuristic definition | indian naika parineeti chora video | pandav jagar | tahira syed | bath bbw hot | youtuber momy cris tin | indian bangla coda | festival di sanremo 1976 | চখের পানি | movierulz plz download | x8c3vi6 | روتيني سكس غسل | selena gomez giantess | া অপু বিশ্বাসকিতানোদাচুদি photos video downlod www com জোর করে 3gp dounlod ভিডিও ড | psx primer | www india naika comla mp3 fock song banglagoogle girls video facebook | কোয়েল এর | x8yswuy | los pepes colombia | x8z7gxy | majadaerrji | think like monk jay shetty free pdf | g g g g baby baby | part25 | nacho sunder komola nache by | loreal revitalift anne thongprasom 15sec |